Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SARS-CoV-2 Nucleocapsid-3xHA-IRES-mcherry
(Plasmid #173030)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173030 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MscV-IRES-mcherry
  • Backbone size w/o insert (bp) 6502
  • Total vector size (bp) 7759
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    mcherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Nucleocapsid phosphoprotein
  • Alt name
    NCP
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    1257
  • GenBank ID
    BCG67561.1
  • Promoter Gag (truncated)
  • Tags / Fusion Proteins
    • 3xHA (C terminal on insert)
    • IRES-mcherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATGTCTGATAATGGACCCCAAAATCAGC
  • 3′ sequencing primer GGCCTGAGTTGAGTCAGCACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fareh lab cloned this construct for this study (BioRxiv--Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SARS-CoV-2 Nucleocapsid-3xHA-IRES-mcherry was a gift from Mohamed Fareh (Addgene plasmid # 173030 ; http://n2t.net/addgene:173030 ; RRID:Addgene_173030)
  • For your References section:

    Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance. Fareh M, Zhao W, Hu W, Casan JML, Kumar A, Symons J, Zerbato JM, Fong D, Voskoboinik I, Ekert PG, Rudraraju R, Purcell DFJ, Lewin SR, Trapani JA. Nat Commun. 2021 Jul 13;12(1):4270. doi: 10.1038/s41467-021-24577-9. 10.1038/s41467-021-24577-9 PubMed 34257311