SARS-CoV-2 Nucleocapsid-3xHA-IRES-mcherry
(Plasmid #173030)

• Purpose: To express SARS-CoV-2 Nucleocapsid protein tagged with 3xHA and in frame with mcherry (NCP-IRES-mcherry) in mammalian cells
• Depositing Lab: Mohamed Fareh
• Publication: Fareh et al Nat Commun. 2021 Jul 13;12(1):4270. doi: 10.1038/s41467-021-24577-9.

Backbone

• Vector backbone: MscV-IRES-mcherry
• Backbone size w/o insert (bp): 6502
• Total vector size (bp): 7759
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: mcherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 Nucleocapsid phosphoprotein
• Alt name: NCP
• Species: SARS-CoV-2
• Insert Size (bp): 1257
• GenBank ID: BCG67561.1
• Promoter: Gag (truncated)
• Tags / Fusion Proteins:
  • 3xHA (C terminal on insert)
  • IRES-mcherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: ATGTCTGATAATGGACCCCAAAATCAGC
• 3′ sequencing primer: GGCCTGAGTTGAGTCAGCACT

Resource Information

• Supplemental Documents:
  • pMSCV-SARS-CoV-2 NCP-3xHA-IRES-mcherry.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Fareh lab cloned this construct for this study (BioRxiv--Reprogrammed CRISPR-Cas13b suppresses SARS-CoV-2 replication and circumvents its mutational escape through mismatch tolerance)