Skip to main content

pAAV-hSyn-Flpo-3xFLAG
(Plasmid #173047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Flpo
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1281
  • Promoter hSyn1
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer caaactccccttcccggc
  • 3′ sequencing primer atccacatagcgtaaaagga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This construct contains sequences taken from the following plasmids: pAAV-hSyn1-tTA (Addegene, no. 99119), pAAV-EF1a-mCherry-IRES-Flpo (Addgene, no. 55634), and pSF-CMV-NEO-COOH-3XFLAG (Sigma-Aldrich, OGS629).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-Flpo-3xFLAG was a gift from Kenji Mizuseki (Addgene plasmid # 173047 ; http://n2t.net/addgene:173047 ; RRID:Addgene_173047)
  • For your References section:

    Intersectional, anterograde transsynaptic targeting of neurons receiving monosynaptic inputs from two upstream regions. Kitanishi T, Tashiro M, Kitanishi N, Mizuseki K. Commun Biol. 2022 Feb 21;5(1):149. doi: 10.1038/s42003-022-03096-3. 10.1038/s42003-022-03096-3 PubMed 35190665