pPB UbC Arrestin-uTEV2-V5; UAS-mCherry
(Plasmid
#173123)
-
PurposeExpresses uTEV2 and reporter receiver construct in DIPG
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPB
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArrestin-uTEV2-V5; UAS-mCherry
- Promoter UbC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgaagctccggttttgaactatgcgctcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB UbC Arrestin-uTEV2-V5; UAS-mCherry was a gift from Alice Ting (Addgene plasmid # 173123 ; http://n2t.net/addgene:173123 ; RRID:Addgene_173123) -
For your References section:
A light-gated transcriptional recorder for detecting cell-cell contacts. Cho KF, Gillespie SM, Kalogriopoulos NA, Quezada MA, Jacko M, Monje M, Ting AY. Elife. 2022 Mar 21;11:e70881. doi: 10.7554/eLife.70881. 10.7554/eLife.70881 PubMed 35311648