pAAV-hSyn-Mito-HyPerGRt
(Plasmid
#173198)
-
PurposeAAV transfer plasmid for a HyPer7 and tdTomato fusion under hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hSyn
- Backbone size w/o insert (bp) 4268
- Total vector size (bp) 7371
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHyper7-tdTomato
-
Alt nameHyPerGRT
-
SpeciesSynthetic
-
Insert Size (bp)3089
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer agctgctagcaaggatcccatcg
- 3′ sequencing primer ctttcacaaattttgtaatccagag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-Mito-HyPerGRt was a gift from Huiwang Ai (Addgene plasmid # 173198 ; http://n2t.net/addgene:173198 ; RRID:Addgene_173198) -
For your References section:
Ratiometric Imaging of Mitochondrial Hydrogen Peroxide in Abeta42-Mediated Neurotoxicity. Li X, Zhang Y, Ai HW. ACS Sens. 2022 Feb 28. doi: 10.1021/acssensors.1c01381. 10.1021/acssensors.1c01381 PubMed 35226474