ATP1A1_T804N_hPGK1_mScarlet-I-TOSI_Donor
(Plasmid
#173208)
-
PurposeHDR donor plasmid to introduce the T804N mutation conferring cellular resistance to ouabain and the mScarlet-I mTOR signaling indicator (TOSI) cassette to ATP1A1 intron 17.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 5652
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersOuabain
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP1A1-T804N mScarlet-I-TOSI donor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5652
- Promoter hPGK1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TGAGCGAGGAAGCGGAAGAG
- 3′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be used in combination with pX330_ATP1A1_G7 or eSpCas9(1.1)_No_FLAG_ATP1A1_G7 to target mScarlet-I mTOR Signaling Indicator (mSc-TOSI) to ATP1A1 intron 17. This reporter can be used to monitor mTORC1 signaling in human cells. A user-specified transgene of interest can also be cloned using restriction cloning sites upstream (KpnI, AflII) and downstream (XhoI, PmeI, SbfI) of the mSc-TOSI gene cassette. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATP1A1_T804N_hPGK1_mScarlet-I-TOSI_Donor was a gift from Yannick Doyon (Addgene plasmid # 173208 ; http://n2t.net/addgene:173208 ; RRID:Addgene_173208) -
For your References section:
Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338