pPBT-peRNA_GG-Puro
(Plasmid
#173220)
-
PurposepiggyBac transposon containing hU6 promotor and pegRNA cloning site
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 173220-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 173220-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPBT
- Total vector size (bp) 6945
-
Vector typeMammalian Expression ; piggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepegRNA cloning cassette
-
Alt namepegRNA-GG-acceptor (BsmBI)
-
Insert Size (bp)1063
- Promoter hU6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuroR
-
Alt namePuromycin
-
Alt namePuro
-
Insert Size (bp)600
- Promoter EF1-a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGTTTCCCCACACTGAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 173220-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 173220-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBT-peRNA_GG-Puro was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 173220 ; http://n2t.net/addgene:173220 ; RRID:Addgene_173220) -
For your References section:
piggyPrime: High-Efficacy Prime Editing in Human Cells Using piggyBac-Based DNA Transposition. Wolff JH, Haldrup J, Thomsen EA, Andersen S, Mikkelsen JG. Front Genome Ed. 2021 Nov 12;3:786893. doi: 10.3389/fgeed.2021.786893. eCollection 2021. 10.3389/fgeed.2021.786893 PubMed 34870275