pPBT-peRNA_GG-Puro
(Plasmid
#173220)
-
PurposepiggyBac transposon containing hU6 promotor and pegRNA cloning site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPBT
- Total vector size (bp) 6945
-
Vector typeMammalian Expression ; piggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepegRNA cloning cassette
-
Alt namepegRNA-GG-acceptor (BsmBI)
-
Insert Size (bp)1063
- Promoter hU6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuroR
-
Alt namePuromycin
-
Alt namePuro
-
Insert Size (bp)600
- Promoter EF1-a
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGTTTCCCCACACTGAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBT-peRNA_GG-Puro was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 173220 ; http://n2t.net/addgene:173220 ; RRID:Addgene_173220) -
For your References section:
piggyPrime: High-Efficacy Prime Editing in Human Cells Using piggyBac-Based DNA Transposition. Wolff JH, Haldrup J, Thomsen EA, Andersen S, Mikkelsen JG. Front Genome Ed. 2021 Nov 12;3:786893. doi: 10.3389/fgeed.2021.786893. eCollection 2021. 10.3389/fgeed.2021.786893 PubMed 34870275