Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ArpC2_pLib
(Plasmid #173679)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173679 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLib
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5798
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ArpC2
  • Alt name
    actin related protein 2/3 complex subunit 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    915
  • Promoter polyhedrin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40-polyA-Rev)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ArpC2_pLib was a gift from Roberto Dominguez (Addgene plasmid # 173679 ; http://n2t.net/addgene:173679 ; RRID:Addgene_173679)
  • For your References section:

    Cryo-EM structure of NPF-bound human Arp2/3 complex and activation mechanism. Zimmet A, Van Eeuwen T, Boczkowska M, Rebowski G, Murakami K, Dominguez R. Sci Adv. 2020 Jun 5;6(23). pii: 6/23/eaaz7651. doi: 10.1126/sciadv.aaz7651. Print 2020 Jun. 10.1126/sciadv.aaz7651 PubMed 32917641