Skip to main content

pTM-BPL
(Plasmid #173766)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173766 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo vector
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5439
  • Total vector size (bp) 6449
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PDGF receptor TM domain, Biotin protein ligase
  • Alt name
    BPL
  • Species
    Synthetic
  • Insert Size (bp)
    1010
  • GenBank ID
  • Promoter CMV
  • Tags / Fusion Proteins
    • Signal peptide (N terminal on backbone)
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer AATTAACCCTCACTAAAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTM-BPL was a gift from Shinji Sueda (Addgene plasmid # 173766 ; http://n2t.net/addgene:173766 ; RRID:Addgene_173766)
  • For your References section:

    Fluorescent Labeling of the Nuclear Envelope by Localizing Green Fluorescent Protein on the Inner Nuclear Membrane. Taniyama T, Tsuda N, Sueda S. ACS Chem Biol. 2018 Jun 15;13(6):1463-1469. doi: 10.1021/acschembio.8b00219. Epub 2018 May 24. 10.1021/acschembio.8b00219 PubMed 29782140