pUAS-Myc-BirA-G3-ER
(Plasmid #173815)

• Purpose: Promiscuous biotin ligase (BirA-G3) targeted to ER lumen expressed from UAS enhancer. N-terminal secretion signal from Drosophila BiP. C-terminal KDEL. Myc tag inserted after sig. seq. cleavage site
• Depositing Lab: Norbert Perrimon
• Publication: Droujinine et al Nat Commun. 2021 Apr 22;12(1):2382. doi: 10.1038/s41467-021-22599-x.

Backbone

• Vector backbone: pWalium10-roe
• Backbone manufacturer: Drosophila Genomics Resource Center
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Myc-BirA-G3-ER
• Alt name: BirA-G3-ER
• Alt name: BiP-Myc-BirA-G3-KDEL
• Promoter: UAS
• Tag / Fusion Protein:
  • Myc

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: accagcaaccaagtaaatcaac
• 3′ sequencing primer: TAATCGTGTGTGATGCCTACC

Resource Information

• Supplemental Documents:
  • pUAS-Myc-BirA-G3-ER.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

BirA-G3 sequence obtained from the Ting Lab:

Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Efficient proximity labeling in living cells and organisms with TurboID. Nat Biotechnol. 2018 Oct;36(9):880-887. doi: 10.1038/nbt.4201. Epub 2018 Aug 20. Erratum in: Nat Biotechnol. 2020 Jan;38(1):108. PMID: 30125270; PMCID: PMC6126969.