pUAS-Myc-BirA-G3-ER
(Plasmid
#173815)
-
PurposePromiscuous biotin ligase (BirA-G3) targeted to ER lumen expressed from UAS enhancer. N-terminal secretion signal from Drosophila BiP. C-terminal KDEL. Myc tag inserted after sig. seq. cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepWalium10-roe
-
Backbone manufacturerDrosophila Genomics Resource Center
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMyc-BirA-G3-ER
-
Alt nameBirA-G3-ER
-
Alt nameBiP-Myc-BirA-G3-KDEL
- Promoter UAS
-
Tag
/ Fusion Protein
- Myc
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer accagcaaccaagtaaatcaac
- 3′ sequencing primer TAATCGTGTGTGATGCCTACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BirA-G3 sequence obtained from the Ting Lab:
Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Efficient proximity labeling in living cells and organisms with TurboID. Nat Biotechnol. 2018 Oct;36(9):880-887. doi: 10.1038/nbt.4201. Epub 2018 Aug 20. Erratum in: Nat Biotechnol. 2020 Jan;38(1):108. PMID: 30125270; PMCID: PMC6126969.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAS-Myc-BirA-G3-ER was a gift from Norbert Perrimon (Addgene plasmid # 173815 ; http://n2t.net/addgene:173815 ; RRID:Addgene_173815) -
For your References section:
Proteomics of protein trafficking by in vivo tissue-specific labeling. Droujinine IA, Meyer AS, Wang D, Udeshi ND, Hu Y, Rocco D, McMahon JA, Yang R, Guo J, Mu L, Carey DK, Svinkina T, Zeng R, Branon T, Tabatabai A, Bosch JA, Asara JM, Ting AY, Carr SA, McMahon AP, Perrimon N. Nat Commun. 2021 Apr 22;12(1):2382. doi: 10.1038/s41467-021-22599-x. 10.1038/s41467-021-22599-x PubMed 33888706