Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
(Plasmid #173862)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173862 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG-N1 (modified pEGFP-N1)
  • Backbone manufacturer
    Modified from Clontech
  • Backbone size w/o insert (bp) 5085
  • Total vector size (bp) 9135
  • Modifications to backbone
    CMV promoter was replaced by CAG promoter, and EGFP was removed.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
  • Species
    H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
  • Insert Size (bp)
    4050
  • Promoter CAG
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • C-terminal CAAX-box (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGGTTATTGTGCTGTCTCATC
  • 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax was a gift from Takao Nakata (Addgene plasmid # 173862 ; http://n2t.net/addgene:173862 ; RRID:Addgene_173862)
  • For your References section:

    Optogenetic control of PIP3: PIP3 is sufficient to induce the actin-based active part of growth cones and is regulated via endocytosis. Kakumoto T, Nakata T. PLoS One. 2013 Aug 7;8(8):e70861. doi: 10.1371/journal.pone.0070861. eCollection 2013. 10.1371/journal.pone.0070861 PubMed 23951027