AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
(Plasmid
#173862)
-
PurposeMammalian expression of Akt PH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax (PIP3 marker and opto-PI3K)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG-N1 (modified pEGFP-N1)
-
Backbone manufacturerModified from Clontech
- Backbone size w/o insert (bp) 5085
- Total vector size (bp) 9135
-
Modifications to backboneCMV promoter was replaced by CAG promoter, and EGFP was removed.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
-
SpeciesH. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)4050
- Promoter CAG
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- C-terminal CAAX-box (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGGTTATTGTGCTGTCTCATC
- 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax was a gift from Takao Nakata (Addgene plasmid # 173862 ; http://n2t.net/addgene:173862 ; RRID:Addgene_173862) -
For your References section:
Optogenetic control of PIP3: PIP3 is sufficient to induce the actin-based active part of growth cones and is regulated via endocytosis. Kakumoto T, Nakata T. PLoS One. 2013 Aug 7;8(8):e70861. doi: 10.1371/journal.pone.0070861. eCollection 2013. 10.1371/journal.pone.0070861 PubMed 23951027