Skip to main content

pBCCP-GFP-NLS
(Plasmid #173923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173923 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQBI 25-fA1
  • Backbone manufacturer
    FUJIFILM Wako Chemicals U.S.A. Corporation
  • Backbone size w/o insert (bp) 5484
  • Total vector size (bp) 6543
  • Modifications to backbone
    Deletion of the GFP coding sequence
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Biotin carboxyl carrier protein, AcGFP1
  • Alt name
    BCCP
  • Species
    Synthetic
  • Insert Size (bp)
    1060
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xNLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBCCP-GFP-NLS was a gift from Shinji Sueda (Addgene plasmid # 173923 ; http://n2t.net/addgene:173923 ; RRID:Addgene_173923)
  • For your References section:

    Fluorescent Labeling of the Nuclear Envelope by Localizing Green Fluorescent Protein on the Inner Nuclear Membrane. Taniyama T, Tsuda N, Sueda S. ACS Chem Biol. 2018 Jun 15;13(6):1463-1469. doi: 10.1021/acschembio.8b00219. Epub 2018 May 24. 10.1021/acschembio.8b00219 PubMed 29782140