pD2_miniluc_newP7
(Plasmid
#174105)
-
Purposeadding the mini luciferase and mini promoter to the MPRA lenti construct
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneColE1/pMB1/pBR322/pUC origin of replication
- Total vector size (bp) 2887
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemini luciferase mini-promoter
-
Insert Size (bp)212
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CACACAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2_miniluc_newP7 was a gift from Paul Khavari (Addgene plasmid # 174105 ; http://n2t.net/addgene:174105 ; RRID:Addgene_174105) -
For your References section:
Integrative analyses highlight functional regulatory variants associated with neuropsychiatric diseases. Guo MG, Reynolds DL, Ang CE, Liu Y, Zhao Y, Donohue LKH, Siprashvili Z, Yang X, Yoo Y, Mondal S, Hong A, Kain J, Meservey L, Fabo T, Elfaki I, Kellman LN, Abell NS, Pershad Y, Bayat V, Etminani P, Holodniy M, Geschwind DH, Montgomery SB, Duncan LE, Urban AE, Altman RB, Wernig M, Khavari PA. Nat Genet. 2023 Nov;55(11):1876-1891. doi: 10.1038/s41588-023-01533-5. Epub 2023 Oct 19. 10.1038/s41588-023-01533-5 PubMed 37857935