Skip to main content

pD2_miniluc_newP7
(Plasmid #174105)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174105 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1/pMB1/pBR322/pUC origin of replication
  • Total vector size (bp) 2887
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mini luciferase mini-promoter
  • Insert Size (bp)
    212

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • 3′ sequencing primer CACACAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD2_miniluc_newP7 was a gift from Paul Khavari (Addgene plasmid # 174105 ; http://n2t.net/addgene:174105 ; RRID:Addgene_174105)
  • For your References section:

    Integrative analyses highlight functional regulatory variants associated with neuropsychiatric diseases. Guo MG, Reynolds DL, Ang CE, Liu Y, Zhao Y, Donohue LKH, Siprashvili Z, Yang X, Yoo Y, Mondal S, Hong A, Kain J, Meservey L, Fabo T, Elfaki I, Kellman LN, Abell NS, Pershad Y, Bayat V, Etminani P, Holodniy M, Geschwind DH, Montgomery SB, Duncan LE, Urban AE, Altman RB, Wernig M, Khavari PA. Nat Genet. 2023 Nov;55(11):1876-1891. doi: 10.1038/s41588-023-01533-5. Epub 2023 Oct 19. 10.1038/s41588-023-01533-5 PubMed 37857935