Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTETRIS-cargo
(Plasmid #126033)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    piggyBac cargo vector
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Mammalian Expression, Luciferase ; piggyBac
  • Promoter TRE
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGATAGAGAACGTATGTCGAGGTAG
  • 3′ sequencing primer GTCAGTGAGCGAGGAAGCTCGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Luciferase was cloned from pGl4.10-Luciferase (Promega). TRE promoter was cloned from pTRE-Tight (Clontech).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTETRIS-cargo was a gift from Mauro Calabrese (Addgene plasmid # 126033 ; http://n2t.net/addgene:126033 ; RRID:Addgene_126033)
  • For your References section:

    Functional classification of long non-coding RNAs by k-mer content. Kirk JM, Kim SO, Inoue K, Smola MJ, Lee DM, Schertzer MD, Wooten JS, Baker AR, Sprague D, Collins DW, Horning CR, Wang S, Chen Q, Weeks KM, Mucha PJ, Calabrese JM. Nat Genet. 2018 Oct;50(10):1474-1482. doi: 10.1038/s41588-018-0207-8. Epub 2018 Sep 17. 10.1038/s41588-018-0207-8 [pii] PubMed 30224646