lentiCRISPR v2-Blast
(Plasmid #83480)

• Purpose: Mammalian expression of Cas9 and sgRNA scaffold
• Depositing Lab: Mohan Babu
• Publication: CRISPR/Cas9-based system for loss-of-function screening (unpublished)

Backbone

• Vector backbone: lentiCRISPR v2 (#52961)
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 14873
• Modifications to backbone: puromycin N-acetyltransferase was replaced by blasticidin S deaminase
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: No more than 16-hour culture.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Blasticidin S deaminase
• Mutation: Replaced puromycin N-acetyltransferase on the original plasmid
• Promoter: EF-1α

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: TGCTGAAACAAGCCGGAGAT
• 3′ sequencing primer: AATTAGCCCTTCCAGTCCCC, WPRE_R

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Feng Zhang (backbone from lentiCRISPR v2 #52961, insert from lentiCas9-Blast #52962).
• Articles Citing this Plasmid:
  • 66 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

lentiCas9-Blast was digested with BamHI and SacII. The resulting small fragment (encoding P2A, blasticidin and a portion of WPRE) was gel-purified. lentiCRISPR v2 was similarly digested and the larger fragment gel-purified. The two fragments combined and ligated.