Skip to main content

VPS13D^mScarlet
(Plasmid #174110)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174110 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.4
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 20000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon optimized VPS13D
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    14112
  • Mutation
    With an internal mScarlet tag in aminoacid position 1576
  • Promoter CMV
  • Tag / Fusion Protein
    • mScarlet

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This was synthesized by Genscript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VPS13D^mScarlet was a gift from Pietro De Camilli (Addgene plasmid # 174110 ; http://n2t.net/addgene:174110 ; RRID:Addgene_174110)
  • For your References section:

    VPS13D bridges the ER to mitochondria and peroxisomes via Miro. Guillen-Samander A, Leonzino M, Hanna MG, Tang N, Shen H, De Camilli P. J Cell Biol. 2021 May 3;220(5). pii: 212021. doi: 10.1083/jcb.202010004. 10.1083/jcb.202010004 PubMed 33891013