pAAV-EF1a-mitoGFP-DIO
(Plasmid
#174112)
-
PurposeCre-dependent expression of mitochondria-targeted Green Fluorescent Protein under control of the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174112 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-EF1a-double floxed-mCherry-WPRE-HGHpA
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 5604
- Total vector size (bp) 6476
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemitoGFP
-
Alt nameCox8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)872
-
Entrez GeneCOX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)
- Promoter Ef1a
-
Tags
/ Fusion Proteins
- Cox8 targeting sequence (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGATTGTAGCTGCTATTAGC
- 3′ sequencing primer GGCAAATAACTTCGTATAGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe mitoGFP gene was derived from plasmid #44385, deposited by the lab of Pantelis Tsoulfas
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.04.07.487496 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-mitoGFP-DIO was a gift from Maarten Kole (Addgene plasmid # 174112 ; http://n2t.net/addgene:174112 ; RRID:Addgene_174112) -
For your References section:
Parvalbumin basket cell myelination accumulates axonal mitochondria to internodes. Kole K, Voesenek BJB, Brinia ME, Petersen N, Kole MHP. Nat Commun. 2022 Dec 9;13(1):7598. doi: 10.1038/s41467-022-35350-x. 10.1038/s41467-022-35350-x PubMed 36494349