Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiCRISPRv2_RB1#2
(Plasmid #174151)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RB1
  • Alt name
    osrc
  • gRNA/shRNA sequence
    GGGTCCTCCTCAGGAGGGGG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (destroyed during cloning)
  • 3′ cloning site BsmbI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2_RB1#2 was a gift from Julien Sage (Addgene plasmid # 174151 ; http://n2t.net/addgene:174151 ; RRID:Addgene_174151)
  • For your References section:

    The AMBRA1 E3 ligase adaptor regulates the stability of cyclin D. Chaikovsky AC, Li C, Jeng EE, Loebell S, Lee MC, Murray CW, Cheng R, Demeter J, Swaney DL, Chen SH, Newton BW, Johnson JR, Drainas AP, Shue YT, Seoane JA, Srinivasan P, He A, Yoshida A, Hipkins SQ, McCrea E, Poltorack CD, Krogan NJ, Diehl JA, Kong C, Jackson PK, Curtis C, Petrov DA, Bassik MC, Winslow MM, Sage J. Nature. 2021 Apr;592(7856):794-798. doi: 10.1038/s41586-021-03474-7. Epub 2021 Apr 14. 10.1038/s41586-021-03474-7 PubMed 33854239