Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEZT-GST-SLFN2-T2
(Plasmid #174321)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174321 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEZT
  • Vector type
    Mammalian Expression ; Bacmam, Baculovirus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GST-SLFN2-K242A, K249A, Q301A
  • Alt name
    Shl
  • Alt name
    Shlf2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1137
  • Entrez Gene
    Slfn2 (a.k.a. Shlf2)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CTG GGC TTG TCG AGA CAG AGA
  • 3′ sequencing primer AATGAAAGCCATACGGGAAGCAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEZT-GST-SLFN2-T2 was a gift from Bruce Beutler (Addgene plasmid # 174321 ; http://n2t.net/addgene:174321 ; RRID:Addgene_174321)
  • For your References section:

    SLFN2 protection of tRNAs from stress-induced cleavage is essential for T cell-mediated immunity. Yue T, Zhan X, Zhang D, Jain R, Wang KW, Choi JH, Misawa T, Su L, Quan J, Hildebrand S, Xu D, Li X, Turer E, Sun L, Moresco EMY, Beutler B. Science. 2021 May 14;372(6543). pii: 372/6543/eaba4220. doi: 10.1126/science.aba4220. 10.1126/science.aba4220 PubMed 33986151