pCE1
(Plasmid
#174434)
-
PurposeCandida optimized monomeric eGFP with RIPLING linker sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2242
- Total vector size (bp) 2983
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCandida optimized monomeric GFP
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cacatttccccgaaaagtg
- 3′ sequencing primer CTCACTGCCCGCTTTCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCE1 was a gift from Clarissa Nobile (Addgene plasmid # 174434 ; http://n2t.net/addgene:174434 ; RRID:Addgene_174434) -
For your References section:
A Markerless CRISPR-Mediated System for Genome Editing in Candida auris Reveals a Conserved Role for Cas5 in the Caspofungin Response. Ennis CL, Hernday AD, Nobile CJ. Microbiol Spectr. 2021 Dec 22;9(3):e0182021. doi: 10.1128/Spectrum.01820-21. Epub 2021 Nov 3. 10.1128/Spectrum.01820-21 PubMed 34730409