HA-SOCS1
(Plasmid
#174571)
-
PurposeHuman HA-tagged SOCS1 expression (N-term. tag) (CMV prom.)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene Plasmid #48140
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHA-SOCS1
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtttaagggatggttggttggtgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.29.486051 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-SOCS1 was a gift from Mathew Garnett (Addgene plasmid # 174571 ; http://n2t.net/addgene:174571 ; RRID:Addgene_174571) -
For your References section:
Base editing screens map mutations affecting interferon-gamma signaling in cancer. Coelho MA, Cooper S, Strauss ME, Karakoc E, Bhosle S, Goncalves E, Picco G, Burgold T, Cattaneo CM, Veninga V, Consonni S, Dincer C, Vieira SF, Gibson F, Barthorpe S, Hardy C, Rein J, Thomas M, Marioni J, Voest EE, Bassett A, Garnett MJ. Cancer Cell. 2023 Feb 13;41(2):288-303.e6. doi: 10.1016/j.ccell.2022.12.009. Epub 2023 Jan 19. 10.1016/j.ccell.2022.12.009 PubMed 36669486