Skip to main content

pCH6 - pBait-ChiX
(Plasmid #174662)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174662 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF and pBAD
  • Backbone size w/o insert (bp) 3900
  • Total vector size (bp) 3971
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChiX
  • Species
    E. coli
  • Insert Size (bp)
    78
  • GenBank ID
  • Promoter pBad
  • Tag / Fusion Protein
    • 1xMS2 hairpin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCGGTAACCCCGCTTATTAAAAGC
  • 3′ sequencing primer TATCAGACCGCTTCTGCGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCH6 - pBait-ChiX was a gift from Katherine Berry (Addgene plasmid # 174662 ; http://n2t.net/addgene:174662 ; RRID:Addgene_174662)
  • For your References section:

    Genetic identification of the functional surface for RNA binding by Escherichia coli ProQ. Pandey S, Gravel CM, Stockert OM, Wang CD, Hegner CL, LeBlanc H, Berry KE. Nucleic Acids Res. 2020 May 7;48(8):4507-4520. doi: 10.1093/nar/gkaa144. 10.1093/nar/gkaa144 PubMed 32170306