pCH6 - pBait-ChiX
(Plasmid #174662)

• Purpose: arabinose-induced synthesis of a hybrid RNA containing a single MS2 hairpin followed by E coli ChiX inserted between XmaI and HindIII sites. Insert can be replaced with RNA bait of interest.
• Depositing Lab: Katherine Berry
• Publication: Pandey et al Nucleic Acids Res. 2020 May 7;48(8):4507-4520. doi: 10.1093/nar/gkaa144.

Backbone

• Vector backbone: pCDF and pBAD
• Backbone size w/o insert (bp): 3900
• Total vector size (bp): 3971
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ChiX
• Species: E. coli
• Insert Size (bp): 78
• GenBank ID:
• Promoter: pBad
• Tag / Fusion Protein:
  • 1xMS2 hairpin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCGGTAACCCCGCTTATTAAAAGC
• 3′ sequencing primer: TATCAGACCGCTTCTGCGTTC

Resource Information

• Supplemental Documents:
  • pCH6_pCDF_pBAD_1xMS2_ChiX.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry