Bnip3L RNAi pSuper-retro
(Plasmid
#17468)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSuper-retro
- Backbone size w/o insert (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBnip3L RNAi
-
Alt nameBnip3L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)60
-
Entrez GeneBNIP3L (a.k.a. BNIP3a, NIP3L, NIX)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer na (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: AACAGTTCCTGGGTGGAGCTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Bnip3L RNAi pSuper-retro was a gift from Wafik El-Deiry (Addgene plasmid # 17468 ; http://n2t.net/addgene:17468 ; RRID:Addgene_17468) -
For your References section:
Bnip3L is induced by p53 under hypoxia, and its knockdown promotes tumor growth. Fei P, Wang W, Kim SH, Wang S, Burns TF, Sax JK, Buzzai M, Dicker DT, McKenna WG, Bernhard EJ, El-Deiry WS. Cancer Cell. 2004 Dec . 6(6):597-609. 10.1016/j.ccr.2004.10.012 PubMed 15607964