Skip to main content

pFB_ROSA26_SpCas9_gRNAs
(Plasmid #174703)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174703 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFB
  • Backbone size w/o insert (bp) 4587
  • Total vector size (bp) 5814
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 dual gRNAs
  • gRNA/shRNA sequence
    gRNA upstream 1: 5’ GTATGCTATACGAAGTTATT 3’, gRNA downstream 2: 5’ AAAGAATTGATTTGATACCG 3’
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CCTAGGACTAGAGAGAGGGC
  • 3′ sequencing primer AAGACACACAACCAAAAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB_ROSA26_SpCas9_gRNAs was a gift from Beverly L. Davidson (Addgene plasmid # 174703 ; http://n2t.net/addgene:174703 ; RRID:Addgene_174703)
  • For your References section:

    Standard screening methods underreport AAV-mediated transduction and gene editing. Lang JF, Toulmin SA, Brida KL, Eisenlohr LC, Davidson BL. Nat Commun. 2019 Jul 30;10(1):3415. doi: 10.1038/s41467-019-11321-7. 10.1038/s41467-019-11321-7 PubMed 31363095