Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRSF-G1pCNPRS
(Plasmid #174719)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174719 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRSF
  • Backbone size w/o insert (bp) 2452
  • Total vector size (bp) 3274
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tRNA synthetase
  • Alt name
    G1pCNPRS
  • Species
    Methanogenic archaeon ISO4-G1
  • Insert Size (bp)
    822
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSF-G1pCNPRS was a gift from Thomas Huber (Addgene plasmid # 174719 ; http://n2t.net/addgene:174719 ; RRID:Addgene_174719)
  • For your References section:

    Genetic Encoding of Cyanopyridylalanine for In-Cell Protein Macrocyclization by the Nitrile-Aminothiol Click Reaction. Abdelkader EH, Qianzhu H, George J, Frkic RL, Jackson CJ, Nitsche C, Otting G, Huber T. Angew Chem Int Ed Engl. 2022 Jan 31. doi: 10.1002/anie.202114154. 10.1002/anie.202114154 PubMed 35102680