p35u4
(Plasmid
#174786)
-
PurposeConstitutive expression of λCI fused via three alanines to the MS2 coat protein. Useful as RNA-DNA adapter in three-hybrid system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
- Total vector size (bp) 3423
-
Modifications to backbonea 113bp deletion is present upstream of constitutive promoter; this plasmid was selected in a mutagenesis screen.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2 coat protein
-
Alt nameMS2cp
-
SpeciesBacteriophage MS2
-
Insert Size (bp)378
-
MutationV30I, A81G, positions 68-80 deleted (VATQTVGGVELPV), cloned behind a EFPGIHPGM linker
- Promoter Synthetic Constitutive Promoter
-
Tag
/ Fusion Protein
- λCI
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGACCAAAACGATCTCAAGAAGATCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p35u4 was a gift from Katherine Berry (Addgene plasmid # 174786 ; http://n2t.net/addgene:174786 ; RRID:Addgene_174786) -
For your References section:
Optimization of a bacterial three-hybrid assay through in vivo titration of an RNA-DNA adapter protein. Wang CD, Mansky R, LeBlanc H, Gravel CM, Berry KE. RNA. 2021 Apr;27(4):513-526. doi: 10.1261/rna.077404.120. Epub 2021 Jan 26. 10.1261/rna.077404.120 PubMed 33500316