YL-CashGem-BAT1-URA3-LINEAR
(Plasmid
#174837)
-
PurposepRS414 backbone containing LINEAR fragment targeting BAT1 in Y. lipolytica
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS414
-
Vector typeBacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
-
Selectable markersTRP1, URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized Cas9:hGem
-
SpeciesY. lipolytica
-
Insert Size (bp)4515
- Promoter GPDp
-
Tag
/ Fusion Protein
- hGeminin tag
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atggacaagaagtactccat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YL-CashGem-BAT1-URA3-LINEAR was a gift from Zengyi Shao (Addgene plasmid # 174837 ; http://n2t.net/addgene:174837 ; RRID:Addgene_174837) -
For your References section:
A repackaged CRISPR platform increases homology-directed repair for yeast engineering. Ploessl D, Zhao Y, Cao M, Ghosh S, Lopez C, Sayadi M, Chudalayandi S, Severin A, Huang L, Gustafson M, Shao Z. Nat Chem Biol. 2021 Oct 28. pii: 10.1038/s41589-021-00893-5. doi: 10.1038/s41589-021-00893-5. 10.1038/s41589-021-00893-5 PubMed 34711982