HEK3_pegF_18bp
(Plasmid
#174852)
-
PurposeExpress forward pegRNA mediating 991-bp deletion and 18-bp insertion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174852 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6
- Total vector size (bp) 2325
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHEK3_pegF_18bp insertion
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HEK3_pegF_18bp was a gift from Wen Xue (Addgene plasmid # 174852 ; http://n2t.net/addgene:174852 ; RRID:Addgene_174852) -
For your References section:
Deletion and replacement of long genomic sequences using prime editing. Jiang T, Zhang XO, Weng Z, Xue W. Nat Biotechnol. 2021 Oct 14. pii: 10.1038/s41587-021-01026-y. doi: 10.1038/s41587-021-01026-y. 10.1038/s41587-021-01026-y PubMed 34650270