Skip to main content

p6XHis-T7(P266L)
(Plasmid #174866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174866 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 2706
  • Total vector size (bp) 5427
  • Modifications to backbone
    Upstream lac promoter and operator are added as well as RBS
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use BL21(DE3) for protein expression
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    T7 RNA polymerase
  • Species
    T7 bacteriophage
  • Insert Size (bp)
    2721
  • Mutation
    P266L
  • Promoter lac promoter
  • Tag / Fusion Protein
    • 6XHis-tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGACCATG
  • 3′ sequencing primer CGTTCTCGGAGCACTGTCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

An earlier reference about P266L :
A mutation in T7 RNA polymerase that facilitates promoter clearance (PMID: 15831591)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6XHis-T7(P266L) was a gift from Anna Pyle (Addgene plasmid # 174866 ; http://n2t.net/addgene:174866 ; RRID:Addgene_174866)
  • For your References section:

    Native Purification and Analysis of Long RNAs. Chillon I, Marcia M, Legiewicz M, Liu F, Somarowthu S, Pyle AM. Methods Enzymol. 2015;558:3-37. doi: 10.1016/bs.mie.2015.01.008. Epub 2015 Feb 27. 10.1016/bs.mie.2015.01.008 PubMed 26068736