Skip to main content

eSpCas9-EF-5Usp5
(Plasmid #174873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 8519
  • Modifications to backbone
    We applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013).
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA for mouse Usp5
  • Alt name
    Usp5 ubiquitin specific peptidase 5 (Mus musculus)
  • gRNA/shRNA sequence
    GACGATCCGTGTCCCCAAGG
  • Species
    Synthetic
  • GenBank ID
  • Entrez Gene
    Usp5 (a.k.a. AA407472, ISOT, ISOT-1, Ucht)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1_5_primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9-EF-5Usp5 was a gift from Hiroshi Ochiai (Addgene plasmid # 174873 ; http://n2t.net/addgene:174873 ; RRID:Addgene_174873)
  • For your References section:

    STREAMING-tag system reveals spatiotemporal relationships between transcriptional regulatory factors and transcriptional activity. Ohishi H, Shimada S, Uchino S, Li J, Sato Y, Shintani M, Owada H, Ohkawa Y, Pertsinidis A, Yamamoto T, Kimura H, Ochiai H. Nat Commun. 2022 Dec 20;13(1):7672. doi: 10.1038/s41467-022-35286-2. 10.1038/s41467-022-35286-2 PubMed 36539402