Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

eSpCas9-EF-5Wnk1
(Plasmid #174874)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174874 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 8519
  • Modifications to backbone
    We applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013).
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA for mouse Wnk1
  • Alt name
    Wnk1 WNK lysine deficient protein kinase 1 (Mus musculus)
  • gRNA/shRNA sequence
    GGTGCCGCCGAGAAGCAAAG
  • Species
    Synthetic
  • GenBank ID
  • Entrez Gene
    Wnk1 (a.k.a. 6430573H23Rik, EG406236, Hsn2, Prkwnk1, mKIAA0344)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO1_5_primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9-EF-5Wnk1 was a gift from Hiroshi Ochiai (Addgene plasmid # 174874 ; http://n2t.net/addgene:174874 ; RRID:Addgene_174874)
  • For your References section:

    STREAMING-tag system reveals spatiotemporal relationships between transcriptional regulatory factors and transcriptional activity. Ohishi H, Shimada S, Uchino S, Li J, Sato Y, Shintani M, Owada H, Ohkawa Y, Pertsinidis A, Yamamoto T, Kimura H, Ochiai H. Nat Commun. 2022 Dec 20;13(1):7672. doi: 10.1038/s41467-022-35286-2. 10.1038/s41467-022-35286-2 PubMed 36539402