Skip to main content

pQ39-VC
(Plasmid #175061)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175061 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    invitrogen
  • Backbone size w/o insert (bp) 3944
  • Total vector size (bp) 5633
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    polyQ39
  • Alt name
    polyQ39 tagged with mVenus-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1689
  • Mutation
    mVenus: C-Terminal deletion of 11 aa (GITLGMDELYK); mCherry: C-Terminal deletion of 5 aa (DELYK) and N-Terminal deletion of 7 aa (MVSKGEE)
  • GenBank ID
    NM_002111.8
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter CMV Promoter
  • Tag / Fusion Protein
    • mVenus + mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQ39-VC was a gift from Arnold Boersma (Addgene plasmid # 175061 ; http://n2t.net/addgene:175061 ; RRID:Addgene_175061)
  • For your References section:

    A FRET-based method for monitoring structural transitions in protein self-organization. Wan Q, Mouton SN, Veenhoff LM, Boersma AJ. Cell Rep Methods. 2022 Mar 28;2(3):100184. doi: 10.1016/j.crmeth.2022.100184. eCollection 2022 Mar 28. 10.1016/j.crmeth.2022.100184 PubMed 35475219