Skip to main content

pCI-neo VPS54-13Myc
(Plasmid #175095)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175095 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI-neo
  • Backbone size w/o insert (bp) 5456
  • Total vector size (bp) 9059
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VPS54
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3051
  • Entrez Gene
    VPS54 (a.k.a. HCC8, PPP1R164, SLP-8p, VPS54L, WR, hVps54L)
  • Promoter CMV
  • Tag / Fusion Protein
    • 13Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer CCACTCCCAGTTCAATTACAGCTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-neo VPS54-13Myc was a gift from Juan Bonifacino (Addgene plasmid # 175095 ; http://n2t.net/addgene:175095 ; RRID:Addgene_175095)
  • For your References section:

    A neurodevelopmental disorder caused by mutations in the VPS51 subunit of the GARP and EARP complexes. Gershlick DC, Ishida M, Jones JR, Bellomo A, Bonifacino JS, Everman DB. Hum Mol Genet. 2019 May 1;28(9):1548-1560. doi: 10.1093/hmg/ddy423. 10.1093/hmg/ddy423 PubMed 30624672