mCherry-E2
(Plasmid
#175242)
-
PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMagic
-
Backbone manufacturerlab stock, see comments
- Backbone size w/o insert (bp) 5300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUBE2I
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1251
-
Entrez GeneUBE2I (a.k.a. C358B7.1, P18, UBC9)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CAAGGGGTTATGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
His 6, Tev, amp resistant, cloning sites: EcoRI, BamHI, XhoI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-E2 was a gift from Michael Rosen (Addgene plasmid # 175242 ; http://n2t.net/addgene:175242 ; RRID:Addgene_175242) -
For your References section:
Mechanistic dissection of increased enzymatic rate in a phase-separated compartment. Peeples W, Rosen MK. Nat Chem Biol. 2021 Jun;17(6):693-702. doi: 10.1038/s41589-021-00801-x. Epub 2021 May 25. 10.1038/s41589-021-00801-x PubMed 34035521