- 
            PurposeBicistronic FUCCI construct driven by a CAG promoter. Contains I-SceI sites for transgenesis
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175266 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepISce-Dest
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameFUCCI
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)8622
- Promoter CAG
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer aaaaagcaggcttcaccgtc (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: CAG FUCCI was a gift from James Monaghan (Addgene plasmid # 175266 ; http://n2t.net/addgene:175266 ; RRID:Addgene_175266)
- 
                For your References section: A constitutively expressed fluorescent ubiquitination-based cell-cycle indicator (FUCCI) in axolotls for studying tissue regeneration. Duerr TJ, Jeon EK, Wells KM, Villanueva A, Seifert AW, McCusker CD, Monaghan JR. Development. 2022 Mar 15;149(6). pii: 274737. doi: 10.1242/dev.199637. Epub 2022 Mar 17. 10.1242/dev.199637 PubMed 35266986
