ALPaGA
(Plasmid
#175272)
-
PurposeLactate biosensor in anaerobic conditions
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB4K5
- Backbone size w/o insert (bp) 3416
- Total vector size (bp) 5603
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLldR_Synthetic_promoter_sfGFP
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)2227
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcggatacccttactctgttgaaaacg
- 3′ sequencing primer TCTTACTGAAGCACGATTCTACTCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ALPaGA was a gift from Jerome Bonnet (Addgene plasmid # 175272 ; http://n2t.net/addgene:175272 ; RRID:Addgene_175272) -
For your References section:
Engineered l-Lactate Responding Promoter System Operating in Glucose-Rich and Anoxic Environments. Zuniga A, Camacho M, Chang HJ, Fristot E, Mayonove P, Hani EH, Bonnet J. ACS Synth Biol. 2021 Dec 1. doi: 10.1021/acssynbio.1c00456. 10.1021/acssynbio.1c00456 PubMed 34851606