Skip to main content

pAAV-SynaptoTAG2
(Plasmid #175275)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175275 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 4561
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-Synaptobrevin-2; tdTomato
  • Insert Size (bp)
    2576
  • Entrez Gene
    Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • tdTomato (P2A cleavage) (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sequencing may be difficult due to secondary structure/dimerization. The following primers have been used in the Xu lab:
5': actcagcgctgcctcagtc (upstream of tdTomato)
3': ggccatgttgttgtcctcggaggaggcggtgc (in tdTomato)
5': gggcatggcaccggcagcaccggcagcggcagc (in tdTomato)
3': gctgaacttgtggccgtttacgtcg (in EGFP)
3': cagggtcagcttgccgtaggtggcatcg (in EGFP)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-SynaptoTAG2 was a gift from Wei Xu (Addgene plasmid # 175275 ; http://n2t.net/addgene:175275 ; RRID:Addgene_175275)
  • For your References section:

    Anterograde transneuronal tracing and genetic control with engineered yellow fever vaccine YFV-17D. Li E, Guo J, Oh SJ, Luo Y, Oliveros HC, Du W, Arano R, Kim Y, Chen YT, Eitson J, Lin DT, Li Y, Roberts T, Schoggins JW, Xu W. Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9. 10.1038/s41592-021-01319-9 PubMed 34824475