Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FUW-C-prM-E-NS1
(Plasmid #175281)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175281 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUW
  • Backbone size w/o insert (bp) 9317
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C-prM-E-NS1 and EGFP
  • Species
    Yellow fever virus strain 17D
  • Insert Size (bp)
    4733
  • Entrez Gene
    POLY (a.k.a. YFVgp1)
  • Promoter human ubiquitin C
  • Tag / Fusion Protein
    • IRES EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatgcgctcggggttggcgagtg
  • 3′ sequencing primer CTCCTCATAAAGAGACAGCAACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-C-prM-E-NS1 was a gift from Wei Xu (Addgene plasmid # 175281 ; http://n2t.net/addgene:175281 ; RRID:Addgene_175281)
  • For your References section:

    Anterograde transneuronal tracing and genetic control with engineered yellow fever vaccine YFV-17D. Li E, Guo J, Oh SJ, Luo Y, Oliveros HC, Du W, Arano R, Kim Y, Chen YT, Eitson J, Lin DT, Li Y, Roberts T, Schoggins JW, Xu W. Nat Methods. 2021 Nov 25. pii: 10.1038/s41592-021-01319-9. doi: 10.1038/s41592-021-01319-9. 10.1038/s41592-021-01319-9 PubMed 34824475