pExpreS2-1-GFP
(Plasmid
#175363)
-
PurposeZeoR overexpression of cytosolic GFP in Drosophila ExpreS2ion cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepExpreS2-1
-
Backbone manufacturerExpreS2ion Biotechnologies
- Backbone size w/o insert (bp) 2549
-
Modifications to backboneNone
-
Vector typeInsect Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgGFP
-
Alt nameSuperGlo Green Fluorescent Protein
-
SpeciesM. victoria
-
Insert Size (bp)726
-
MutationF64L, S65C, and I167T
-
GenBank IDUniProt P42212.1
- Promoter Fused Actin-HSP70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACAAGACAGGTTTAAGGAGAC
- 3′ sequencing primer GCGCTTGAAAGGAGTGTGTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pExpreS2-1-GFP was a gift from ExpreS2ion Biotechnologies (Addgene plasmid # 175363 ; http://n2t.net/addgene:175363 ; RRID:Addgene_175363) -
For your References section:
FAS2FURIOUS: Moderate-Throughput Secreted Expression of Difficult Recombinant Proteins in Drosophila S2 Cells. Coker JA, Katis VL, Fairhead M, Schwenzer A, Clemmensen SB, Frandsen BU, de Jongh WA, Gileadi O, Burgess-Brown NA, Marsden BD, Midwood KS, Yue WW. Front Bioeng Biotechnol. 2022 May 5;10:871933. doi: 10.3389/fbioe.2022.871933. eCollection 2022. 10.3389/fbioe.2022.871933 PubMed 35600892