pExpreS2-1-C3-10H-SIII
(Plasmid
#175444)
-
Purpose(Empty Backbone) HiFi-compatible destination vector for secreted overexpression of 3C-cleavable, C-terminal 10His-TwinStrep tagged proteins with ExpreS2 Platform
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepExpreS2-1
-
Backbone manufacturerExpreS2ion Biotechnologies
- Backbone size (bp) 2763
-
Modifications to backboneAdded HiFi-compatible MCS which introduces an N-terminal BiP secretion peptide and a C-terminal, 3C-cleavable 10His-TwinStrep tag
-
Vector typeInsect Expression
- Promoter Fused Actin-HSP70
-
Selectable markersZeocin
-
Tags
/ Fusion Proteins
- BiP Secretion Peptide (N terminal on insert)
- 3C-10His-TwinStrep (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAAGACAGGTTTAAGGAGAC
- 3′ sequencing primer GCGCTTGAAAGGAGTGTGTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is designed for use with the ExpreS2 Platform from ExpreS2ion Biotechnologies. It is intended to be used with the ExpreS2ion cells and media which can be obtained directly from the ExpreS2ion website.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pExpreS2-1-C3-10H-SIII was a gift from Wyatt Yue (Addgene plasmid # 175444 ; http://n2t.net/addgene:175444 ; RRID:Addgene_175444) -
For your References section:
FAS2FURIOUS: Moderate-Throughput Secreted Expression of Difficult Recombinant Proteins in Drosophila S2 Cells. Coker JA, Katis VL, Fairhead M, Schwenzer A, Clemmensen SB, Frandsen BU, de Jongh WA, Gileadi O, Burgess-Brown NA, Marsden BD, Midwood KS, Yue WW. Front Bioeng Biotechnol. 2022 May 5;10:871933. doi: 10.3389/fbioe.2022.871933. eCollection 2022. 10.3389/fbioe.2022.871933 PubMed 35600892