-
PurposeExpresses dCasRx-ALKBH5 in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCasRx-ALKBH5
-
Alt nameNLS-dRfxCas13d-NLS-ALKBH5
-
Insert Size (bp)4668
-
MutationRfxCas13d R239A/H244A/R858A/H863A
- Promoter pMSCV
-
Tag
/ Fusion Protein
- FLAG-HA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCCAAGAAGAAGAGAAAGGTGGAGG
- 3′ sequencing primer GTGCCGCCGCATCTTCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-dCasRx-ALKBH5-PURO was a gift from Qi Xie (Addgene plasmid # 175582 ; http://n2t.net/addgene:175582 ; RRID:Addgene_175582) -
For your References section:
Epitranscriptomic editing of the RNA N6-methyladenosine modification by dCasRx conjugated methyltransferase and demethylase. Xia Z, Tang M, Ma J, Zhang H, Gimple RC, Prager BC, Tang H, Sun C, Liu F, Lin P, Mei Y, Du R, Rich JN, Xie Q. Nucleic Acids Res. 2021 Jul 21;49(13):7361-7374. doi: 10.1093/nar/gkab517. 10.1093/nar/gkab517 PubMed 34181729