Skip to main content

pMesh1
(Plasmid #175594)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175594 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBbA5a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mesh1
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    537
  • Mutation
    Codon optimized for translation in E.coli. AGGAGGAAAAAA RBS added before the start codon
  • Entrez Gene
    Mesh1 (a.k.a. Dmel_CG11900, CG11900, Dmel\CG11900, Q9VAM9)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GCGTAGAGGATCGAGATCG
  • 3′ sequencing primer GTGTGACTCTAGTAGAGAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Mesh1 is cloned from synthetic codon optimized DNA we ordered from a company

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMesh1 was a gift from Greg Bokinsky (Addgene plasmid # 175594 ; http://n2t.net/addgene:175594 ; RRID:Addgene_175594)
  • For your References section:

    ppGpp is a bacterial cell size regulator. Buke F, Grilli J, Cosentino Lagomarsino M, Bokinsky G, Tans SJ. Curr Biol. 2022 Feb 28;32(4):870-877.e5. doi: 10.1016/j.cub.2021.12.033. Epub 2022 Jan 5. 10.1016/j.cub.2021.12.033 PubMed 34990598