pMesh1
(Plasmid
#175594)
-
PurposeLac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbA5a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMesh1
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)537
-
MutationCodon optimized for translation in E.coli. AGGAGGAAAAAA RBS added before the start codon
-
Entrez GeneMesh1 (a.k.a. Dmel_CG11900, CG11900, Dmel\CG11900, Q9VAM9)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGTAGAGGATCGAGATCG
- 3′ sequencing primer GTGTGACTCTAGTAGAGAGCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMesh1 is cloned from synthetic codon optimized DNA we ordered from a company
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMesh1 was a gift from Greg Bokinsky (Addgene plasmid # 175594 ; http://n2t.net/addgene:175594 ; RRID:Addgene_175594) -
For your References section:
ppGpp is a bacterial cell size regulator. Buke F, Grilli J, Cosentino Lagomarsino M, Bokinsky G, Tans SJ. Curr Biol. 2022 Feb 28;32(4):870-877.e5. doi: 10.1016/j.cub.2021.12.033. Epub 2022 Jan 5. 10.1016/j.cub.2021.12.033 PubMed 34990598