pAd5-B6/7deltaE3
(Plasmid
#175748)
-
PurposeA block for the AdenoBuilder genome assembly system. The insert consolidates the regions present in pAd5-B6deltaE3 and pAd5-B7.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJet1.2
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 10943
-
Vector typeAdenoviral, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAdenovirus 5 genomic region 25043-35938
-
SpeciesAdenovirus 5
-
MutationAdenovirus sequences 27859-30803 replaced with BamHI-SalI cloning site, resulting in deletion of E3
-
GenBank IDAC_000008.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd5-B6/7deltaE3 was a gift from Fred Bunz (Addgene plasmid # 175748 ; http://n2t.net/addgene:175748 ; RRID:Addgene_175748) -
For your References section:
AdenoBuilder: A platform for the modular assembly of recombinant adenoviruses. Jang Y, Bunz F. STAR Protoc. 2022 Jan 20;3(1):101123. doi: 10.1016/j.xpro.2022.101123. eCollection 2022 Mar 18. 10.1016/j.xpro.2022.101123 PubMed 35098167