-
PurposeEncodes 5xTAPE-1 construct that can be integrated using piggyBAC system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepiggyBAC-BlastR
- Backbone size w/o insert (bp) 6165
- Total vector size (bp) 6279
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name5xTAPE-1 construct
-
Insert Size (bp)114
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piggyBAC-5xTAPE-1-BlastR was a gift from Jay Shendure (Addgene plasmid # 175808 ; http://n2t.net/addgene:175808 ; RRID:Addgene_175808) -
For your References section:
A time-resolved, multi-symbol molecular recorder via sequential genome editing. Choi J, Chen W, Minkina A, Chardon FM, Suiter CC, Regalado SG, Domcke S, Hamazaki N, Lee C, Martin B, Daza RM, Shendure J. Nature. 2022 Jul 6. pii: 10.1038/s41586-022-04922-8. doi: 10.1038/s41586-022-04922-8. 10.1038/s41586-022-04922-8 PubMed 35794474