-
PurposeExpress light chain of Fab_8D3_2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176076 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGEN
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 4879
- Total vector size (bp) 5601
-
Modifications to backbonesome small insertions irrelevant to the insert
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLight chain of Fab_8D3_2
-
SpeciesH. sapiens (human), M. musculus (mouse); Chimera
-
Insert Size (bp)723
- Promoter CAG promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTAACCATGTTCATGCCTTCTTC
- 3′ sequencing primer GTGGTATTTGTGAGCCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Fab_8D3_2_L was a gift from Tom Rapoport (Addgene plasmid # 176076 ; http://n2t.net/addgene:176076 ; RRID:Addgene_176076) -
For your References section:
Cryo-EM structure determination of small proteins by nanobody-binding scaffolds (Legobodies). Wu X, Rapoport TA. Proc Natl Acad Sci U S A. 2021 Oct 12;118(41). pii: 2115001118. doi: 10.1073/pnas.2115001118. 10.1073/pnas.2115001118 PubMed 34620716