Skip to main content

pCAG-Fab_8D3_2_L
(Plasmid #176076)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176076 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGEN
  • Backbone manufacturer
    addgene
  • Backbone size w/o insert (bp) 4879
  • Total vector size (bp) 5601
  • Modifications to backbone
    some small insertions irrelevant to the insert
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Light chain of Fab_8D3_2
  • Species
    H. sapiens (human), M. musculus (mouse); Chimera
  • Insert Size (bp)
    723
  • Promoter CAG promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTAACCATGTTCATGCCTTCTTC
  • 3′ sequencing primer GTGGTATTTGTGAGCCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Fab_8D3_2_L was a gift from Tom Rapoport (Addgene plasmid # 176076 ; http://n2t.net/addgene:176076 ; RRID:Addgene_176076)
  • For your References section:

    Cryo-EM structure determination of small proteins by nanobody-binding scaffolds (Legobodies). Wu X, Rapoport TA. Proc Natl Acad Sci U S A. 2021 Oct 12;118(41). pii: 2115001118. doi: 10.1073/pnas.2115001118. 10.1073/pnas.2115001118 PubMed 34620716