Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBx1-VHH template2-3XMyc-Spacer
(Plasmid #176209)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176209 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBx1
  • Backbone size w/o insert (bp) 2561
  • Total vector size (bp) 3256
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VHH template2-3XMyc-Spacer
  • Species
    Synthetic
  • Insert Size (bp)
    695
  • Promoter T7
  • Tag / Fusion Protein
    • Myc tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCACCTGACGTCGACGGATCGGGA
  • 3′ sequencing primer TCCTTTCGGGCTTTGTTAGCAGCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBx1-VHH template2-3XMyc-Spacer was a gift from Aviv Regev (Addgene plasmid # 176209 ; http://n2t.net/addgene:176209 ; RRID:Addgene_176209)
  • For your References section:

    A cell-free nanobody engineering platform rapidly generates SARS-CoV-2 neutralizing nanobodies. Chen X, Gentili M, Hacohen N, Regev A. Nat Commun. 2021 Sep 17;12(1):5506. doi: 10.1038/s41467-021-25777-z. 10.1038/s41467-021-25777-z PubMed 34535642