Skip to main content
Addgene

pAAV-hAdipoq-GFP
(Plasmid #176215)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176215 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CBA-w
  • Backbone size w/o insert (bp) 5050
  • Total vector size (bp) 5773
  • Modifications to backbone
    The CBA promoter in the pAAV-CBA-W backbone was replaced with the human Adiponectin enhancer and promoter sequences.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    723

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AACTACTCGAGaccatggtgagcaagggcga
  • 3′ sequencing primer TATTCAGCGGCCGCTTACTTGTACAGCTCGTCCATGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Gfp cDNA was derived from pLenti-GFP-Blast (Addgene, plasmid #17445).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hAdipoq-GFP was a gift from Yu-Hua Tseng (Addgene plasmid # 176215 ; http://n2t.net/addgene:176215 ; RRID:Addgene_176215)
  • For your References section:

    FGF6 and FGF9 regulate UCP1 expression independent of brown adipogenesis. Shamsi F, Xue R, Huang TL, Lundh M, Liu Y, Leiria LO, Lynes MD, Kempf E, Wang CH, Sugimoto S, Nigro P, Landgraf K, Schulz T, Li Y, Emanuelli B, Kothakota S, Williams LT, Jessen N, Pedersen SB, Bottcher Y, Bluher M, Korner A, Goodyear LJ, Mohammadi M, Kahn CR, Tseng YH. Nat Commun. 2020 Mar 17;11(1):1421. doi: 10.1038/s41467-020-15055-9. 10.1038/s41467-020-15055-9 PubMed 32184391