Skip to main content
Addgene

pcDNA3.1(+) mCherry
(Plasmid #176301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 176301 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Total vector size (bp) 6071
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+) mCherry was a gift from Jeremy Wilusz (Addgene plasmid # 176301 ; http://n2t.net/addgene:176301 ; RRID:Addgene_176301)
  • For your References section:

    CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells. Ai Y, Liang D, Wilusz JE. Nucleic Acids Res. 2022 Mar 4. pii: 6542487. doi: 10.1093/nar/gkac159. 10.1093/nar/gkac159 PubMed 35244715