-
PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 7411
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehuman codon optimized Cas13bt1 (catalytically inactivated)
-
SpeciesAtlantic deep subsurface metagenome
-
Insert Size (bp)2409
-
MutationR95A/H100A/R769A/H773A
- Promoter EFS (short EF1alpha)
-
Tag
/ Fusion Protein
- HIV NES (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccgccagaacacaggaaactta
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehuADAR2dd(E488Q)
-
Alt namehuman ADAR2 deaminase domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1158
-
MutationE488Q, only the deaminase domain (aa 276-702 are expressed)
-
Entrez GeneADARB1 (a.k.a. ADAR2, DRABA2, DRADA2, NEDHYMS, RED1)
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Gene/Insert 3
-
Gene/Insert nameCas13bt1 crRNA + BpiI cloning site
-
SpeciesAtlantic deep subsurface metagenome
-
Insert Size (bp)57
- Promoter hU6
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB2076 pAAV REPAIR.t1 was a gift from Feng Zhang (Addgene plasmid # 176323 ; http://n2t.net/addgene:176323 ; RRID:Addgene_176323) -
For your References section:
Compact RNA editors with small Cas13 proteins. Kannan S, Altae-Tran H, Jin X, Madigan VJ, Oshiro R, Makarova KS, Koonin EV, Zhang F. Nat Biotechnol. 2021 Aug 30. pii: 10.1038/s41587-021-01030-2. doi: 10.1038/s41587-021-01030-2. 10.1038/s41587-021-01030-2 PubMed 34462587