pGFP-Ub-VPS13D_dC
(Plasmid
#176466)
-
Purposeexpress VPS13D lacking C-terminal 407 aa in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNational Institute of Neurological Disorders and Strokes (NINDS)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 176466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 176466-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 176466-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3679
- Total vector size (bp) 16794
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS13D
-
Alt nameSCAR4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)11871
-
MutationC-terminal 407 aa is deleted.
-
GenBank IDNM_015378 ENSG00000048707
-
Entrez GeneVPS13D (a.k.a. BLTP5D, SCAR4)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-Ub (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CATTTTATGTTTCAGGTTCAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression.
DNA (Catalog # 176466-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 176466-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-Ub-VPS13D_dC was a gift from Richard Youle (Addgene plasmid # 176466 ; http://n2t.net/addgene:176466 ; RRID:Addgene_176466) -
For your References section:
VPS13D promotes peroxisome biogenesis. Baldwin HA, Wang C, Kanfer G, Shah HV, Velayos-Baeza A, Dulovic-Mahlow M, Bruggemann N, Anding A, Baehrecke EH, Maric D, Prinz WA, Youle RJ. J Cell Biol. 2021 May 3;220(5). pii: 212018. doi: 10.1083/jcb.202001188. 10.1083/jcb.202001188 PubMed 33891012
